Genetic manipulation of PpV in Drosophila

For the PpV rescue construct, a 2679 bp EcoRI fragment from BAC clone 18C-18 (BACPAC Resources Center) was isolated and cloned into the pattB vector (Bischof et al. 2007 (link)). For GFP-PpV, the 5′ terminal 444 bp (a HindIII/EcoRI-BspM1 fragment) was replaced by a corresponding 1229 bp fragment with codon optimized GFP and a linker inserted at the start codon, which was synthesized by Eurofins Genomics and cloned into the pattB vector. CS2-tribbles plasmid template was linearized by XhoI and transcribed by SP6 Transcription Kit (Ambion) (Grosshans and Wieschaus 2000 (link)). dsRNAs were produced by T7 RNA polymerase (Ambion), NTPs, RNase inhibitor (Thermo Fisher) and Pyrophosphatase (Thermo Fisher), using CS2-tribbles as template and dsRNA primers BL10 (GTAATACGACTCACTATAGGGCGATCAGCGCACAGCCTAGTCA) and BL11 (GTAATACGACTCACTATAGGGCGATGGCCATAGATGGTGCTCC) (Farrell and O’Farrell 2013 (link)).

Free full text: Click here

Liu B., Sung H.W, & Großhans J. (2019). Multiple Functions of the Essential Gene PpV in Drosophila Early Development. G3: Genes|Genomes|Genetics, 9(11), 3583-3593.

Publication 2019

SP6 Transcription Kit T7 RNA polymerase RNase inhibitor Pyrophosphatase

Codon Dsrna Ecori Plasmid Primers Pyrophosphatase Rnase Start codon T7 rna polymerase Transcription Vector

Corresponding Organization : Philipps University of Marburg

Top 5 similar protocols

Variable analysis

independent variables

Replacement of the 5' terminal 444 bp (a HindIII/EcoRI-BspM1 fragment) with a corresponding 1229 bp fragment containing codon optimized GFP and a linker inserted at the start codon for the GFP-PpV construct

dependent variables

Not explicitly mentioned

control variables

Not explicitly mentioned

controls

Positive control: CS2-tribbles plasmid template was used as a template for dsRNA production
Negative control: Not explicitly mentioned

Annotations

Based on most similar protocols

Etiam vel ipsum. Morbi facilisis vestibulum nisl. Praesent cursus laoreet felis. Integer adipiscing pretium orci. Nulla facilisi. Quisque posuere bibendum purus. Nulla quam mauris, cursus eget, convallis ac, molestie non, enim. Aliquam congue. Quisque sagittis nonummy sapien. Proin molestie sem vitae urna. Maecenas lorem.

As authors may omit details in methods from publication, our AI will look for missing critical information across the 5 most similar protocols.

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!