Inhibition of NF-κB Signaling in Cryptosporidium parvum Infection

C. parvum oocysts of the Iowa strain were purchased from a commercial source (Bunch Grass Farm, Deary, ID). Murine intestinal epithelial cell line (IEC4.1) was a kind gift from Dr. Pingchang Yang (McMaster University, Hamilton, Canada) and muINTEPI, a murine intestinal epithelial cell line (19 (link)), was purchased from InSCREENeX Cellular Screening Technologies (Germany). SC-514 (100 μM, Calbiochem), a potent IKK-2 inhibitor (20 (link)), and JSH-23 (Santa Cruz Biotechnology, Dallas, TX), a cell-permeable, selective inhibitor of nuclear translocation of NF-кB p65 and its transcription activity (21 (link), 22 (link)), were used to inhibit NF-кB activation. The phosphorothioate oligodeoxynucleotide (ODN), CpG-ODN 1668 (TCCATGACGTTCCTGATGCT), was purchased from Invitrogen (Carlsbad, CA). Lipopolysaccharide (LPS, from E. coli strain K12) was purchased from Invitrogen (San Diego, CA) and IFN-γ and TNF-α were purchased from R&D Systems (Minneapolis, MN). SC-514, TNF-α, IFN-γ and LPS at the utilized concentrations showed no cytotoxic effects on IEC4.1 and muINTEPI cells.

Partial Protocol Preview
This section provides a glimpse into the protocol.
The remaining content is hidden due to licensing restrictions, but the full text is available at the following link: Access Free Full Text.

Li M., Gong A.Y., Zhang X.T., Wang Y., Mathy N.W., Martins G.A., Strauss-Soukup J.K, & Chen X.M. (2018). Induction of a long non-coding RNA transcript, NR_045064, promotes defense gene transcription and facilitates intestinal epithelial cell responses against Cryptosporidium infection. Journal of immunology (Baltimore, Md. : 1950), 201(12), 3630-3640.

Publication 2018

JSH-23 IFN-γ TNF-α

C parvum Cell line Cells Cpg oligodeoxynucleotide E coli k12 Grass Ifn γ Inhibit Intestinal Jsh 23 Murine Oligodeoxynucleotide Oocysts Permeable Sc 514 Strain Tnf α Transcription Translocation

Corresponding Organization : Creighton University

Other organizations : University of California, Los Angeles, Cedars-Sinai Medical Center

Top 5 similar protocols

Variable analysis

independent variables

SC-514 (100 μM, Calbiochem), a potent IKK-2 inhibitor
JSH-23 (Santa Cruz Biotechnology, Dallas, TX), a cell-permeable, selective inhibitor of nuclear translocation of NF-кB p65 and its transcription activity
CpG-ODN 1668 (TCCATGACGTTCCTGATGCT)
Lipopolysaccharide (LPS, from E. coli strain K12)
IFN-γ
TNF-α

dependent variables

Not explicitly mentioned

control variables

Murine intestinal epithelial cell line (IEC4.1)
MuINTEPI, a murine intestinal epithelial cell line

positive controls

Lipopolysaccharide (LPS, from E. coli strain K12)
IFN-γ
TNF-α

negative controls

SC-514, TNF-α, IFN-γ and LPS at the utilized concentrations showed no cytotoxic effects on IEC4.1 and muINTEPI cells

Annotations

Based on most similar protocols

Etiam vel ipsum. Morbi facilisis vestibulum nisl. Praesent cursus laoreet felis. Integer adipiscing pretium orci. Nulla facilisi. Quisque posuere bibendum purus. Nulla quam mauris, cursus eget, convallis ac, molestie non, enim. Aliquam congue. Quisque sagittis nonummy sapien. Proin molestie sem vitae urna. Maecenas lorem.

As authors may omit details in methods from publication, our AI will look for missing critical information across the 5 most similar protocols.

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!