Generation and Validation of Brca1 Mutants

MMC (SCBT), Cisplatin (Sigma Aldrich), ABT-888 (SelleckChem, Houston, TX) and Bleomycin (SCBT, Santa Cruz, CA) were purchased in DMSO or prepared as stocks in DMSO. The Brca1 deletion mutants^{36 (link)} are HA-tagged and correspond to deletions within the Brca1 protein as illustrated in Figure 6d. The Brca1 ΔM3 mutant (aa 1290–1530) was generated from full length HA-Brca1 plasmid³⁷ using methods described in Gibson Assembly Cloning Kit (New England BioLabs) and primer sequences: BRCA1-305-F: CAGAATGAATGTAGAAAAGGCTG, BRCA1-305-1290-del-Rev: gttgctcctccacatcaacaacACATTTTGTTTCCTCACTAAG, BRCA1-305-1290-del-For: cttagtgaggaaacaaaatgtGTTGTTGATGTGGAGGAGCAAC, pcDNA-Xho-rev: TAGGGCCCTCTAGATGCATGC. XhoI and EcoRI restriction digestion and sequencing validated the correct insertion and sequence. The full length myc-Wwox plasmid^{13 (link)} and deletion mutants^{15 (link)} were previously described.

Partial Protocol Preview
This section provides a glimpse into the protocol.
The remaining content is hidden due to licensing restrictions, but the full text is available at the following link: Access Free Full Text.

Schrock M.S., Batar B., Lee J., Druck T., Ferguson B., Cho J.H., Akakpo K., Hagrass H., Heerema N.A., Xia F., Parvin J.D., Aldaz C.M, & Huebner K. (2016). Wwox–Brca1 interaction: role in DNA repair pathway choice. Oncogene, 36(16), 2215-2227.

Publication 2016

Cisplatin ABT-888 Bleomycin Gibson Assembly Cloning Kit

Abt 888 Bleomycin Brca1 Cisplatin Deletion Deletions Digestion Dmso Ecori Primer Wwox

Corresponding Organization :

Other organizations : The Ohio State University Wexner Medical Center, The University of Texas MD Anderson Cancer Center

Top 5 similar protocols

Variable analysis

independent variables

MMC (SCBT)
Cisplatin (Sigma Aldrich)
ABT-888 (SelleckChem, Houston, TX)
Bleomycin (SCBT, Santa Cruz, CA)
Brca1 deletion mutants

dependent variables

Not explicitly mentioned

control variables

Not explicitly mentioned

controls

Positive control: Full length HA-Brca1 plasmid
Negative control: Not specified

Annotations

Based on most similar protocols

Etiam vel ipsum. Morbi facilisis vestibulum nisl. Praesent cursus laoreet felis. Integer adipiscing pretium orci. Nulla facilisi. Quisque posuere bibendum purus. Nulla quam mauris, cursus eget, convallis ac, molestie non, enim. Aliquam congue. Quisque sagittis nonummy sapien. Proin molestie sem vitae urna. Maecenas lorem.

As authors may omit details in methods from publication, our AI will look for missing critical information across the 5 most similar protocols.

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!