MiRNA and mRNA were extracted from rat brain tissues after different time periods (24 h, 48 h and 72 h) of I/R and from PC12 cells after 24 h of OGD/R using an RNA extraction kit (GeneCopoeia, Guangzhou, China). The miRNAs and mRNAs were reverse-transcribed and single-stranded cDNA was synthesized using a Prime Script Reagent Kit (GeneCopoeia, China). Quantitative real-time polymerase chain reaction (qRT-PCR) using specific primers miR-6328 (forward, CTCTGAGCCCCCGCAAA), U6 (HsnRNA U6 primer, GeneCopoeia, Rockville, MD, USA), IKKβ (forward, GTGGTGAGGCTCATGAACGA; reverse, CGGAAGCGGCACAGGATGACC), IL-1β (forward, GGGATGATGACGACCTGCTA; reverse, CCACTTGTTGGCTTATGTTCTG), TNF-α (forward, AGAACTCCAGGCGGTGTCT; reverse, GAGCCCATTTGGGAACTTCT) and Actin (forward, CAGCCTTCCTTCCTGGGTATG; reverse, TAGAGCCACCAATCCACACAG) was performed using a PCR instrument (Life Technologies, Thermo, USA). The 2−ΔΔct method was used to calculate relative expression in samples and control [46 ].
Free full text: Click here