Evaluating miR-132 binding to 3'UTRs

GAT1, PTEN and MeCP2 3´UTR fragments were amplified from genomic DNA using a Q5 High-Fidelity Taq Polymerase, digested with NheI and NotI and cloned in the pmirGLO Dual-Luciferase reporter vector (Promega GmbH, Mannheim, Germany)). All plasmids were sequenced before use. The following primers were used for cloning of GAT1, PTEN and MeCP2 fragments containing a predicted miR-132 binding site: GAT1_fwd: atattagctagccgaccaccacttgatgtctg and GAT1_rev: atattagcggccgcaaaatgcccttttcctgtg; PTEN_fwd: atattagctagctgtgtaatcaaggccagtgc and PTEN_rev: atattagcggccgctcttttttttgtgtgcag; MeCP2_fwd: atattagctagcaaatcgacgcccgagttag and MeCP2_rev: atattagcggccgcgaaaattcctttcacccacca. Plasmids were co-transfected with the miR-132 mimic or a negative control (C.elegans miR-67 mimic) into Hela cells using DharmaFECT Duo transfection reagent (GE Healthcare Dharmacon Inc., Lafayette, CO, USA) according to the manufacturer’s protocol. Firefly luciferase activity was assessed as previously described^{27 (link)} using the Renilla-Glo Luciferase System (Promega) according to the manufacturer’s protocol.