Quantitative Real-Time PCR of Cold-Sensitive Genes

Two cold-sensitive genes Cla020078 (CBF1) and Cla020702 (MYB) were chose to perform quantitative real-time PCR (qRT-PCR). Total RNA was extracted using a RNA extraction kit (Tiangen, Beijing, China) according to the supplier’s instructions. DNA contamination was removed using a purifying column. One microgram of total RNA was reverse-transcribed using the ReverTra Ace qPCR RT Kit (Toyobo, Osaka, Japan) following the supplier’s instructions. The gene-specific primers for qRT-PCR were designed based on their cDNA sequences, as follows: Cla020078 (F, AGCAGAGCCCTAACACAGGT; R, AATGGTCTTGAGTTGGG), Cla020702 (F, GATCCATTGACGGCACTAAC; R, TCGCTACAACGTCCTTCATC), and watermelon β-actin gene (F, CCATGTATGTTGCCATCCAG; R, GGATAGCATGGGGTAGAGCA) was used as an internal control (Kong et al., 2014 (link)). The qRT-PCR assays were performed using an iCycler Iq Multicolor PCR Detection System (Bio-Rad, Hercules, CA, USA). PCRs were performed using the SYBR Premix ExTaq II (2×) Kit (Takara, Tokyo, Japan). The PCR conditions consisted of denaturation at 95°C for 3 min, followed by 40 cycles of denaturation at 95°C for 30 s, annealing at 58°C for 30 s, and extension at 72°C for 30 s. The quantification of mRNA levels was based on the method of Livak and Schmittgen (2001) (link).