For quantitative analysis of mRNA expression, comparative real‐time PCR was performed using the SYBR Green PCR Master Mix (Applied Biosystems). RNA was extracted using TRI‐reagent, treated with the DNA‐free Kit (Ambion). RNA was reverse‐transcribed, using M‐MLV Reverse Transcriptase (Invitrogen). The following primers were used: C. parvum 18S ribosomal RNA (Cp18s) (forward, 5′‐TTGTTCCTTACTCCTTCAGCAC‐3′ and reverse, 5′‐TCCTTCCTATGTCTGGACCTG‐3′), mouse chemokine C‐X‐C motif ligand 2 (Mip‐2) (forward, 5′‐CACTCTCAAGGGCGGTCAAA‐3′ and reverse, 5′‐AGGCACATCAGGTACGATCCA‐3′), mouse nitric oxide synthase 2 (Nos2) (forward, 5′‐ATTTGGGAATGGAGACTGTC‐3′ and reverse, 5′‐CTGAAGGTGTGGTTGAGTTCT‐3′), mouse Dkk1 (forward, 5′‐TCCAACGCGATCAAGAACCT‐3′ and reverse, 5′‐CTCATCTTCAGCGCAAGGGTA‐3′), mouse intercellular adhesion molecule 1 (Icam1) (forward, 5′‐GCTGTTTGAGCTGAGCGAGAT‐3′ and reverse, 5′‐CGGAAACGAATACACGGTGAT‐3′), mouse interleukin 6 (IL‐6) (forward, 5′‐CCCAATTTCCAATGCTCTCCT‐3′ and reverse, 5′‐CATAACGCACTAGGTTTGCCG‐3′), mouse Lrp5 (forward, 5′‐ AACCGCGAGCCATTGTGTT‐3′ and reverse, 5′‐CCCATCTAGGTTGGCGCATT‐3′), mouse Wnt5a (forward, 5′‐AATCCACGCTAAGGGTTCC‐3′ and reverse, 5′‐TACAGGCTACATCTGCCAGG‐3′), mouse Wnt family member 3a (Wnt3a) (forward, 5′‐ATGGTCTCTCGGGAGTTTG‐3′ and reverse, 5′‐CCAGCAGGTCTTCACTTCA‐3′), mouse Lgr5 (forward, 5′‐CCTACTCGAAGACTTACCCAGT‐3′ and reverse, 5′‐GCATTGGGGTGAATGATAGCA‐3′), Sox9 (forward, 5′‐GCACTCTGGGCAATCTCA‐3′ and reverse, 5′‐GCTCAGTTCACCGATGTCC‐3′), mouse cyclin‐dependent kinase inhibitor 2A (p16) (forward, 5′‐TGAGAAGAGGGCCGCACCGGAATC‐3′ and reverse, 5′‐GCACCGGGCGGGAGAAGGTAGTG‐3′). Real‐time PCR was performed in triplicate. The Ct values were analyzed using the comparative Ct (ΔΔCt) method and the amount of target was obtained by normalizing to the endogenous reference (glyceraldehyde‐3‐phosphate dehydrogenase, GAPDH) and relative to the control (nontreated cells) (Chen et al. 2007; Zhou et al. 2012).
Free full text: Click here