Generation of Nts-FlpO Knock-In Mice

We modified the targeting vector used to generate Nts^Cre mice^{26 (link)} to create an Nts^FlpO targeting vector. Briefly, the IRES-Cre was replaced with an IRES-FlpO sequence, such that it is inserted between the stop codon and the polyadenylation site of the sequence encoding the 3’ end of the mouse Nts gene. An frt-flanked NEO cassette lied upstream of the IRES-FlpO for selection purposes. The linearized Nts^FlpO targeting vector was electroporated into mouse R1 embryonic stem (ES) cells (129sv background) and cells were selected with G418. DNA from ES cell clones was analyzed via qPCR for loss of homozygosity using Taqman primer and probes for the genomic Nts insertion sites (Nts-IRES: Forward: TGAAAAGGCAGCTGTATGAAAATAA, Nts-IRES: Reverse: TCAAGAATTAGCTTCTCAGTAGTAGTAGGAA, Nts-IRES: Probe: CCAGAAGGCCCTACATTCTCAAGAGG. NGF was used as a copy number control. Putative positive ES clones were expanded, confirmed for homologous recombination by Southern blot and injected into mouse C57BL/6 blastocysts to generate chimeras. Chimeric males were mated with C57BL/6 females (Jackson Laboratory) and germline transmission was determined initially via progeny coat color, then confirmed via conventional PCR for FlpO (as described below).

Free full text: Click here

Brown J.A., Wright A., Bugescu R., Christensen L., Olson D.P, & Leinninger G.M. (2019). Distinct Subsets of Lateral Hypothalamic Neurotensin Neurons are Activated by Leptin or Dehydration. Scientific Reports, 9, 1873.

Publication 2019

C57BL/6 females

Blastocysts C57bl mouse Cells Chimeric Clones Embryonic Embryonic stem cell Females G418 Gene Genomic Germline Homologous recombination Homozygosity Ires Males Mouse Mouse embryonic stem cells Polyadenylation Primer Southern blot Stem Stop codon Transmission Vector

Corresponding Organization :

Other organizations : Michigan State University, University of Michigan–Ann Arbor

Top 5 similar protocols

Variable analysis

independent variables

Modification of the targeting vector used to generate Nts^Cre mice

dependent variables

Homologous recombination in mouse R1 embryonic stem (ES) cells (129sv background)
Germline transmission in chimeric males mated with C57BL/6 females

control variables

Mouse R1 embryonic stem (ES) cells (129sv background)
C57BL/6 mouse strain

controls

Positive control: NGF as a copy number control for qPCR analysis of Nts insertion sites
Negative control: Not explicitly mentioned

Annotations

Based on most similar protocols

Etiam vel ipsum. Morbi facilisis vestibulum nisl. Praesent cursus laoreet felis. Integer adipiscing pretium orci. Nulla facilisi. Quisque posuere bibendum purus. Nulla quam mauris, cursus eget, convallis ac, molestie non, enim. Aliquam congue. Quisque sagittis nonummy sapien. Proin molestie sem vitae urna. Maecenas lorem.

As authors may omit details in methods from publication, our AI will look for missing critical information across the 5 most similar protocols.

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!