Heterologous Expression of Aspartate Protease

The aspartate protease gene was obtained from NCBI (National Center for Biotechnology Information) with the sequence number XP_001401093.1 and base-substituted using SnapGene 3.2.1 according to P. pastoris codon preference. The optimized gene (apa1) was synthesized by Sangon (Shanghai, China). The synthesized apa1 gene was amplified using PCR with forward primer (GCTCCAGCTCCAACTAGAAAG) and reverse primer (AGCTTGAGCAGCAAAACCC) specific to its sequence. The truncated apa1 gene without the signal peptide coding sequence was cloned into the pPICZαA vector using a one-step cloning ligation. The ligated product was identified by agarose gel electrophoresis and purified by a gel recovery kit. The pPICZαA/apa1 plasmid was validated by sequencing.