The knockout HEK293A cell line was generated as in [38 (link)] using the HEK293A WT (Thermo Fisher Scientific, Waltham, MA, USA) cell line. Briefly, cell clones with deletions in the region of constitutive proteins encoding exons (Supplementary Figure S1A) were obtained using the CRISPR/Cas9 method. The design of the sgRNAs for human PARP1 gene knockout was performed using the Benchling CRISPR tool (https://www.benchling.com/, accessed on 9 November 2019) to delete the DNA sequence that includes 3–5 exons of the PARP1 gene. The selected protospacers PARP1-gRNA1 (CTAGAACCTCCAATACCATG (TGG)) and PARP1-gRNA2 (GCAAGTGACCACAAAGGTGC (AGG) (PAM sequences in brackets)) were cloned in plasmid pSpCas9(BB)-2A-GFP (PX458) (Addgene #48138).
Cell Cell line Crispr DeletionsExons Gene Gene knockout Human Parp1 Plasmid Proteins region
Corresponding Organization :
Other organizations :
Institute of Chemical Biology and Fundamental Medicine, Siberian Branch of the Russian Academy of Sciences, Institute of Cytology and Genetics, Novosibirsk Institute of Organic Chemistry, Novosibirsk State University
CRISPR/Cas9 method used to generate cell clones with deletions in the region of constitutive proteins encoding exons
dependent variables
Cell clones with deletions in the region of constitutive proteins encoding exons
control variables
HEK293A WT (Thermo Fisher Scientific, Waltham, MA, USA) cell line
controls
Negative control: HEK293A WT (Thermo Fisher Scientific, Waltham, MA, USA) cell line
Positive control: Not explicitly mentioned
Annotations
Based on most similar protocols
Etiam vel ipsum. Morbi facilisis vestibulum nisl. Praesent cursus laoreet felis. Integer adipiscing pretium orci. Nulla facilisi. Quisque posuere bibendum purus. Nulla quam mauris, cursus eget, convallis ac, molestie non, enim. Aliquam congue. Quisque sagittis nonummy sapien. Proin molestie sem vitae urna. Maecenas lorem.
As authors may omit details in methods from publication, our AI will look for missing critical information across the 5 most similar protocols.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to
get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
