DNA extraction was performed by boiling S. aureus pellets in 300 µl of TE buffer as described previously [20 (link)]. Detection of 310 bp fragment of mecA was performed using primer pairs: 5′-GTAGAAATGACTGAACGTCCGATAA-3′ and
5′ CCAATTCCACATTGTTTCGGTCTAA −3′ as described previously [21 (link)]. The reaction mixture contained 12.5 µl of hot star master mix (Qiagen, Hilden, Germany), 0.5 µl each of the forward and reverse primers, 9 µl of molecular grade water and 2.5 µl of the template with a final volume of 25 µl. Amplification was carried out with 40 cycles of initial heat activation at 95 °C for 15 min, denaturation at 94 °C for 30 s, followed by annealing at 52 °C for 45 s, extension at 72 °C for 1 min, and final extension at 72 °C for 10 min. The PCR products were analysed by electrophoresis on a 2 % agarose gel.
Free full text: Click here