Quantifying Mitotic Recombination and HR Assays

For spontaneous mitotic recombination assay, cells were pre-sorted by fluorescence-activated cell sorting (FACS) to remove previously accumulated green cells and cultured for indicated days^{10 (link)}. The mitotic recombination frequency was determined by FACS analysis. For I-SceI-induced HR assay, reporter cell lines were infected with retroviruses encoding HA-I-SceI, and EGFP-positive events were scored by FACS analysis 5 days later. FACS analysis was performed using a BD Accuri C6 flow cytometer and accompanying data analysis software (CFlow, Becton-Dickinson).
To analyze HR usage in U2OS (HR-Flex/D-Flex) and U2OS (HR-Luc/D-Luc) cells, genomic DNA was extracted 3 days after I-SceI viral infection and digested with I-SceI, followed by PCR using primers indicated in Fig. 5f (GGATAGCGGTTTGACTCACGGGG and TTACTTGTACAGCTCGTCCATGC). PCR products were digested with or without BamHI and EcoRI and resolved by electrophoresis. The percentage of BamHI and EcoRI digestible PCR products among total DNA was calculated after quantifying DNA bands using Image J.