Total RNA was extracted from osteoblasts and right tibia after treatments, using TRIZOL.
reagent. Reverse transcription was conducted with 0.8 μg of total RNA using the PrimeScript one-step RT-PCR kit. Real-time PCR was carried out in a Real-Time PCR System (Stratagene/Agilent Technologies, Wilmington, DE, USA) using SYBR Premix Ex TaqII. The cycling conditions were as follows: 95 °C for 2 min and 40 cycles of 95 °C for 5 sec, 60 °C for 30 sec [11 (link)]. For each rat, the gene expression was normalized with that of the housekeeping gene Gapdh and expressed as 2-ΔΔCt. The following primers were used [13 (link), 14 (link)]: Gapdh region sense: AGACAGCCGCATCTTCTTGT and region antisense: TGATGGCAACAATGTCCACT; Osx region sense: GGCTTTTCTGTGGCAAGAGGTT and region antisense: CGCTGATGTTTGCTCAAGTGGTC; Alpl region sense: CCAGAAAGACACGTTGACTGTGG, and region antisense: TCTTGTCCGTGTCGCTCACCAT; Ocn region sense: AGCTCAACCCCAATTGTGAC and region antisense: TCCTGGAGAGTAGCCAAAGC; Opn region sense: GCTAAGCCTCAGCATCCTTG and region antisense: AAGCAAACCACTGCCAGTCT; Rage region sense: ACAGAAACCGGTGATGAAGG, and region antisense: ATTCAGCTCTGCACGTTCCCT.
reagent. Reverse transcription was conducted with 0.8 μg of total RNA using the PrimeScript one-step RT-PCR kit. Real-time PCR was carried out in a Real-Time PCR System (Stratagene/Agilent Technologies, Wilmington, DE, USA) using SYBR Premix Ex TaqII. The cycling conditions were as follows: 95 °C for 2 min and 40 cycles of 95 °C for 5 sec, 60 °C for 30 sec [11 (link)]. For each rat, the gene expression was normalized with that of the housekeeping gene Gapdh and expressed as 2-ΔΔCt. The following primers were used [13 (link), 14 (link)]: Gapdh region sense: AGACAGCCGCATCTTCTTGT and region antisense: TGATGGCAACAATGTCCACT; Osx region sense: GGCTTTTCTGTGGCAAGAGGTT and region antisense: CGCTGATGTTTGCTCAAGTGGTC; Alpl region sense: CCAGAAAGACACGTTGACTGTGG, and region antisense: TCTTGTCCGTGTCGCTCACCAT; Ocn region sense: AGCTCAACCCCAATTGTGAC and region antisense: TCCTGGAGAGTAGCCAAAGC; Opn region sense: GCTAAGCCTCAGCATCCTTG and region antisense: AAGCAAACCACTGCCAGTCT; Rage region sense: ACAGAAACCGGTGATGAAGG, and region antisense: ATTCAGCTCTGCACGTTCCCT.
Free full text: Click here
