Lentiviral Overexpression of Mouse and Human GPx2

The open reading frame of mouse GPx2 (GenScript NM_030677.2) was subcloned by PCR into Xho1/BamH1 restriction sites of lentiviral expression vector pLVX-puro (Clontech), using 5’ region primer: 5’-TAT CTC GAG GCC ACC ATG GCT TAC ATT GCC AAG TCG-3’ and 3’ region primer: 5’-TAT GGA TCC CTA GAT GGC AAC TTT GAG GAG CCG-3’, and the open reading frame of human GPx2 (GenScript NM_002083.4) was subcloned by PCR into Xho1/BamH1 restriction sites of lentiviral expression vector pLVX-puro (Clontech), using 5’ region primer: 5’-CCC CTC GAG ATG GCT TTC ATT GCC AAG TCC TTC TAT GAC-3’ and 3’ region primer: 5’-CCC GGA TCC CTA TAT GGC AAC TTT AAG GAG GCG CTT GAT-3’. Recombinant lentiviruses expressing mGPx2 and hGPx2 were packaged in 293 T cells and expressed in PyMT2 and JIMT1 respectively as described below.
The third generation lentiviral transfer plasmid pXPR_dCas9-VPR_sgRNA was cloned from pXPR_dCas9-VP64-Blast (Addgene plasmid #61425) [19 (link)]. For mouse GPx2 sgRNA design, two custom anti-sense DNA oligonucleotides (CTTTGTTCAGTGGCAGTAAG, TTGTTCAAACAGTTCACAGG) were annealed and ligated into pXPR_dCas9-VPR_sgRNA. Non-targeting pXPR_dCas9-VPR with no GPx2-sgRNA inserted recognition sequence was used as a control. Lentiviral construct for dCas9-VPR-sgRNA and virus particles was prepared by Memorial Sloan Kettering Cancer Center, New York.