Gene Silencing in Centrosome-Aberrant Cells

P-Cadherin gene silencing (CDH3) was performed in MCF10A-Plk4p53KO using a validated siRNA, specific for CDH3 (50 nM, Hs_GCDH3_6), with the following target sequence 5’ AAGCCTCTTACCTGCCGTAAA 3′, from Qiagen (USA). P53 gene silencing was performed in MCF10A-Plk4, MCF10A-Plk4^1-608 and RPE-Plk4 cell lines using a specific siRNA (100 nM, L-003329-00-0020, Dharmacon). Transfections were carried out using Lipofectamine 2000 (Invitrogen), according to manufacturer’s recommended procedures. A scrambled siRNA targeting sequence 5’ AAGCCTCTTACCTGCCGTAAA 3′, with no homology to any gene, was used as a negative control (Qiagen, USA). Cells were incubated with the transfection mix for 6 h. After siRNA transfection, cells were incubated for 24 h in the presence or absence of Dox for 24 h (1 µg/ml) to induce extra centrosomes. Gene inhibition was evaluated by western blot after 31 h of cell transfection for the MFE assay and after 47 h for condition media collection.