In order to evaluate gene expression, some follicles in all of the study groups were collected in three replicates (15 follicles in each replicate) at day 12 of culture. Total RNA was extracted from each group using a TRIzol reagent extraction method (Invitrogen, Paisley, UK). The RNA concentration was determined by spectrophotometry and adjusted to a concentration of 400 ng/ml. Using oligo dT, RNA was reverse transcribed by Moloney murine leukemia virus reverse transcriptase. Sequences for gene-specific PCNA, FSHR, and GAPDH primers were as follows: PCNA forward: AGGAGGCGGTAACCATAG, PCNA reverse: ACTCTACAACAAGGGGCACATC; FSHR forward: CCAGGCTGAGTCGTAGCATC, FSHR reverse: GGCGGCAAACCTCTGAACT; and GAPDH forward: GGAAAAGAGCCTAGGGCAT, GAPDH reverse: CTGCCTGACGGCCAGG.[24 (link)] GAPDH gene was used as an internal control.
Protocol detail
Quantifying Gene Expression in Cultured Follicles
Partial Protocol Preview
This section provides a glimpse into the protocol.
The remaining content is hidden due to licensing restrictions, but the full text is available at the following link:
Access Free Full Text.
Follicles
Fshr
Gapdh
Gene
Gene expression
Moloney murine leukemia virus
Oligo dt
Pcna
Primers
Replicate
Reverse transcriptase
Spectrophotometry
Trizol
Corresponding Organization : Islamic Azad University of Tabriz
Other organizations : Birjand University of Medical Sciences, Tarbiat Modares University, Mashhad University of Medical Sciences, Northwest A&F University
Top 5 similar protocols
Protocol cited in 1 other protocol
Variable analysis
independent variables
- Day of culture
- Gene expression of PCNA, FSHR, and GAPDH
- RNA concentration (400 ng/ml)
- GAPDH gene was used as an internal control
Annotations
Based on most similar protocols
Etiam vel ipsum. Morbi facilisis vestibulum nisl. Praesent cursus laoreet felis. Integer adipiscing pretium orci. Nulla facilisi. Quisque posuere bibendum purus. Nulla quam mauris, cursus eget, convallis ac, molestie non, enim. Aliquam congue. Quisque sagittis nonummy sapien. Proin molestie sem vitae urna. Maecenas lorem.
Sign up for free or login to display all annotations
As authors may omit details in methods from publication, our AI will look for missing critical information across the 5 most similar protocols.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!