Inducing Replication Fork Collapse
Partial Protocol Preview
This section provides a glimpse into the protocol.
The remaining content is hidden due to licensing restrictions, but the full text is available at the following link:
Access Free Full Text.
Corresponding Organization :
Other organizations : National Human Genome Research Institute, National Cancer Institute, Dana-Farber Cancer Institute, Harvard University, Broad Institute, John Radcliffe Hospital, MRC Weatherall Institute of Molecular Medicine, University of Oxford, National Institute on Aging, The Francis Crick Institute, Illumina (United States), National Institute of Diabetes and Digestive and Kidney Diseases, Tufts University
Variable analysis
- Addition of 1 μg ml^-1 doxycycline to cell culture medium
- Transfection of siRNAs: siGenome Human siRNA Smartpool targeting WRN, MUS81, and SLX4, as well as non-targeting control pool
- Transfection of WRN 5' UTR (AAACCCGAGAAGAUCCAGUCCAACA)
- Treatment with aphidicolin (0.2 μg ml^-1) for 24 h
- Addition of ATR inhibitor AZ20 (10μM) for the final 8 h
- Expression of shWRN
- Cell culture conditions
- Non-targeting control pool siRNA
- Positive control: Described previously in reference 3
Annotations
Based on most similar protocols
As authors may omit details in methods from publication, our AI will look for missing critical information across the 5 most similar protocols.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!