Inducing Replication Fork Collapse

Expression of shWRN was induced by adding 1 μg ml⁻¹ doxycycline to cell culture medium for indicated time. The following siRNAs were used for experiments: siGenome Human siRNA Smartpool targeting WRN, MUS81, and SLX4, as well as non-targeting control pool (Horizon Discovery). WRN 5′ UTR (AAACCCGAGAAGAUCCAGUCCAACA) was described previously^{3 (link)} and ordered from ThermoFisher. Cells were transfected using RNAiMax Transfection Reagent (ThermoFisher) according to manufacturer’s instructions. To induce exogenous replication fork collapse, cells were treated with aphidicolin (0.2 μg ml⁻¹, Sigma Aldrich) for 24 h, and ATR inhibitor AZ20 (10μM, SelleckChem) was added for the final 8 h.

Partial Protocol Preview
This section provides a glimpse into the protocol.
The remaining content is hidden due to licensing restrictions, but the full text is available at the following link: Access Free Full Text.

van Wietmarschen N., Sridharan S., Nathan W.J., Tubbs A., Chan E.M., Callen E., Wu W., Belinky F., Tripathi V., Wong N., Foster K., Noorbakhsh J., Garimella K., Cruz-Migoni A., Sommers J.A., Huang Y., Borah A.A., Smith J.T., Kalfon J., Kesten N., Fugger K., Walker R.L., Dolzhenko E., Eberle M.A., Hayward B.E., Usdin K., Freudenreich C.H., Brosh RM J.r., West S.C., McHugh P.J., Meltzer P.S., Bass A.J, & Nussenzweig A. (2020). Repeat expansions confer WRN dependence in microsatellite-unstable cancers. Nature, 586(7828), 292-298.

Publication 2020

non-targeting control pool RNAiMax Transfection Reagent aphidicolin ATR inhibitor AZ20

Aphidicolin Cell culture Cells Collapse Culture medium Doxycycline Human Replication Sirna Transfection

Corresponding Organization :

Other organizations : National Human Genome Research Institute, National Cancer Institute, Dana-Farber Cancer Institute, Harvard University, Broad Institute, John Radcliffe Hospital, MRC Weatherall Institute of Molecular Medicine, University of Oxford, National Institute on Aging, The Francis Crick Institute, Illumina (United States), National Institute of Diabetes and Digestive and Kidney Diseases, Tufts University

Top 5 similar protocols

Variable analysis

independent variables

Addition of 1 μg ml^-1 doxycycline to cell culture medium
Transfection of siRNAs: siGenome Human siRNA Smartpool targeting WRN, MUS81, and SLX4, as well as non-targeting control pool
Transfection of WRN 5' UTR (AAACCCGAGAAGAUCCAGUCCAACA)
Treatment with aphidicolin (0.2 μg ml^-1) for 24 h
Addition of ATR inhibitor AZ20 (10μM) for the final 8 h

dependent variables

Expression of shWRN

control variables

Cell culture conditions

controls

Non-targeting control pool siRNA
Positive control: Described previously in reference 3

Annotations

Based on most similar protocols

Etiam vel ipsum. Morbi facilisis vestibulum nisl. Praesent cursus laoreet felis. Integer adipiscing pretium orci. Nulla facilisi. Quisque posuere bibendum purus. Nulla quam mauris, cursus eget, convallis ac, molestie non, enim. Aliquam congue. Quisque sagittis nonummy sapien. Proin molestie sem vitae urna. Maecenas lorem.

As authors may omit details in methods from publication, our AI will look for missing critical information across the 5 most similar protocols.

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!