RNA was prepared from ~100 mg of liver using Trizol (Invitrogen) as described (Clinkenbeard et al., 2012 (link)). One µg of RNA was converted into cDNA using the qscript kit (Quanta Biosciences) according to the manufacturer’s instructions and run in the reverse transcriptase protocol in an iCycler (BioRad). qPCR was carried out using 2.5 µl of 1:10 diluted cDNA with 10 µL of Sybr Green (Quanta Biosciences), 5 µL of primer mix and 2.5 µL of water and analyzed with Bio-rad iCycler. All CT (MyIQ) levels were normalized against ribosomal protein L30 using the ΔΔCt method (Livak and Schmittgen, 2001 (link)). The following primers were used: AFP (ATCAGTGTCTGCTGGCACGCA and GGCTGGGGCATACATGAAGGGG), Lipoprotein lipase (Lpl: TGGCTACACCAAGCTGGTGGGA and GGTGAACGTTGTCTAGGGGGTAGT), Lipocalin 2 (Lcn2: CTACAATGTCACCTCCATCCTG and AGCTCTGTACCTGAGGATACC), ribosomal protein L30 (L30: ATGGTGGCCGCAAAGAAGACGAA and CCTCAAAGCTGGACAGTTGTTGGCA).
Protocol detail
Liver RNA Extraction and qPCR Analysis
Partial Protocol Preview
This section provides a glimpse into the protocol.
The remaining content is hidden due to licensing restrictions, but the full text is available at the following link:
Access Free Full Text.
Corresponding Organization :
Other organizations : University of Kentucky, Markey Cancer Center
Top 5 similar protocols
Variable analysis
independent variables
- RNA preparation method (Trizol)
- CDNA conversion method (qscript kit)
- QPCR method (Sybr Green, primer mixes)
- Gene expression levels of AFP, Lpl, Lcn2
- Tissue type (liver)
- Quantity of starting material (~100 mg)
- Normalization against ribosomal protein L30 using ΔΔCt method
- Positive control: None mentioned
- Negative control: None mentioned
Annotations
Based on most similar protocols
Etiam vel ipsum. Morbi facilisis vestibulum nisl. Praesent cursus laoreet felis. Integer adipiscing pretium orci. Nulla facilisi. Quisque posuere bibendum purus. Nulla quam mauris, cursus eget, convallis ac, molestie non, enim. Aliquam congue. Quisque sagittis nonummy sapien. Proin molestie sem vitae urna. Maecenas lorem.
Sign up for free or login to display all annotations
As authors may omit details in methods from publication, our AI will look for missing critical information across the 5 most similar protocols.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!