Semen was collected from both TG and non-TG bucks using artificial vagina.
Somatic cells were removed from ejaculated sperm by percoll gradient (90%) centrifugation for one hour as described in [10 (link)]. RNA was purified from the separated spermatozoa fraction by RNAzol RT reagent (MRC) according to the manufacturer’s instructions. cDNA were reverse transcribed with Applied Biosystems High-capacity cDNA Reverse Transcription Kit (Life Technologies) from 200 ng RNA. The RT-PCR reactions were set up with MyTaq Red Mix (Bioline) reagent according to the manufacturer’s instructions. The following primer pairs were used to RT-PCR:
Venus specific primer: Forward: 5’ GGTCCCTCTTCTCGTTAGGG 3’
Reverse: 5’ TACAAGACCAGAGCCGAGGT 3’;
Neonatal rabbit Fc receptor specific primer [19 ];
Ribosomal 28S subunit specific primer, Forward: 5' GTTGTTGCCATGGTAATCCTGCTCAGT 3', Reverse: 5' TCTGACTTAGAGGCGTTCAGTCATAAT 3'
Somatic cells were removed from ejaculated sperm by percoll gradient (90%) centrifugation for one hour as described in [10 (link)]. RNA was purified from the separated spermatozoa fraction by RNAzol RT reagent (MRC) according to the manufacturer’s instructions. cDNA were reverse transcribed with Applied Biosystems High-capacity cDNA Reverse Transcription Kit (Life Technologies) from 200 ng RNA. The RT-PCR reactions were set up with MyTaq Red Mix (Bioline) reagent according to the manufacturer’s instructions. The following primer pairs were used to RT-PCR:
Venus specific primer: Forward: 5’ GGTCCCTCTTCTCGTTAGGG 3’
Reverse: 5’ TACAAGACCAGAGCCGAGGT 3’;
Neonatal rabbit Fc receptor specific primer [19 ];
Ribosomal 28S subunit specific primer, Forward: 5' GTTGTTGCCATGGTAATCCTGCTCAGT 3', Reverse: 5' TCTGACTTAGAGGCGTTCAGTCATAAT 3'
Free full text: Click here
