Linc-223 knockdown was obtained by Mission Lentiviral shRNA clones (Sigma-Aldrich, USA). Mission Lentiviral Non-Targeting shRNA clone SHC002 (Sigma-Aldrich, USA) was utilized as control. Lentiviral particles were prepared according to the manufacturer's specifications. Infection of AML cell lines was performed as previously described [32 (link)]. Targeting sequences are CTGTCCTAGAGAAACTTTATA for Sh#1 and CAGCCCAGTACTTTAGTTACA for Sh#2.
For linc-223 ectopic expression, stable and inducible HL-60 cell lines were produced as previously described [15 , 16 (link)]. Briefly, linc-223 cDNA was amplified from HL-60 cells and subcloned in the enhanced PiggyBac (ePB) vector ePB-PURO using the oligonucleotides Linc-223-BamHI-FW and Linc-223-NotI-REV. Deletion of the Drosha cleavage site was obtains by inverse PCR with oligonucleotides Linc-223-mut.223-FW and Linc-223-mut.223-REV generating the EBP-linc223 plasmid. GFP sequence for control EBP was amplified from a commercial EBP plasmid contains a TET-on system for inducible transgene expression. Helper and transposon plasmids were electroporated in HL-60 with the Neon Transfection System (Invitrogen) according to manufacturer instruction. Selection with 1 μg/mL of puromycin (SIGMA) was initiated 2 days after transfection and maintained until resistant colonies became visible.
For linc-223 ectopic expression, stable and inducible HL-60 cell lines were produced as previously described [15 , 16 (link)]. Briefly, linc-223 cDNA was amplified from HL-60 cells and subcloned in the enhanced PiggyBac (ePB) vector ePB-PURO using the oligonucleotides Linc-223-BamHI-FW and Linc-223-NotI-REV. Deletion of the Drosha cleavage site was obtains by inverse PCR with oligonucleotides Linc-223-mut.223-FW and Linc-223-mut.223-REV generating the EBP-linc223 plasmid. GFP sequence for control EBP was amplified from a commercial EBP plasmid contains a TET-on system for inducible transgene expression. Helper and transposon plasmids were electroporated in HL-60 with the Neon Transfection System (Invitrogen) according to manufacturer instruction. Selection with 1 μg/mL of puromycin (SIGMA) was initiated 2 days after transfection and maintained until resistant colonies became visible.
Free full text: Click here
