BKPyV Genome Quantification by qPCR

RPTE cell pellets were lysed in 200 μl of NDA lysis buffer (4 M guanidine thiocyanate, 25 mM Tris, and 134 mM β-mercaptoethanol) and incubated at 56°C for 10 min, after which an equal volume of 100% ethanol was added. DNA was then bound to silica columns by centrifuging at 16,000 × g for 1 min. Columns were washed with buffer 1 (1 M guanidine thiocyanate, 25 mM Tris, pH 7, in 10% ethanol) and centrifuged, followed by a final wash in buffer 2 (25 mM Tris, pH 7, in 70% ethanol). DNA was eluted with nuclease-free water by centrifugation at 16,000 × g. Primers and probe for the BKPyV genome were designed as described in Evans et al. (39 (link)). Human tumor necrosis factor alpha (TNF-α) primers and probe were designed and obtained through TIB MolBiol (forward primer, AGGAACAGCACAGGCCTTAGTG; reverse primer, AAGACCCCTCCCAGATAGATGG; TaqMan probe, CCAGGATGTGGAGAGTGAACCGACATG). A 300 nM concentration of each primer and 50 nM TaqMan probe were used in each qPCR reaction mixture, which was run on a Rotor-Gene instrument (RG-3000; Corbett Research) and subsequently analyzed on Rotor-Gene software. BKPyV genome levels were corrected to the level of the TNF-α control for each sample, and values of uninhibited samples were arbitrarily set to 1 (6 independent experiments). A one-sample t test was conducted to give P values (standard deviations are shown with error bars).