To create the NR4A1_NeonGreen TCR reporter, the coding sequence of mNeonGreen was integrated in-frame into the NR4A1 locus before the stop codon using CRISPR-induced homology directed repair (43 (link)). The mNeonGreen coding sequence (44 (link)) (IDT, Coralville IA) flanked by a 5’ 334bp homology arm, 5’ T2A element and a 315bp 3’ homology arm was electroporated with recombinant spCas9 (IDT) and NR4A1 CRISPR guide RNA (IDT, sequence: AUGAAGAUCUUGUCAAUGAU) into Jurkat clone E6-1 cells (ATCC). Cells were cloned by limiting dilution and the clone with the highest signal upon PMA (5ng/ml) - ionomycin (5μg/ml) (Invivogen) stimulation was identified. The obtained reporter cell line was further modified by CRISPR knock out of TRA/TRB expression (gRNA sequences: AGAGUCUCUCAGCUGGUACA, CAAACACAGCGACCUUGGGU (IDT)); cells with successful knock out were sorted for lack of CD3 expression. The final NR4A1_NeonGreen TCR reporter showed upregulation of the reporter signal according to TCR signal strength, mimicking regulation of the endogenous NR4A1 locus (45 (link)).
Protocol detail
Generation of NR4A1 TCR Reporter Cell Line
Partial Protocol Preview
This section provides a glimpse into the protocol.
The remaining content is hidden due to licensing restrictions, but the full text is available at the following link:
Access Free Full Text.
Corresponding Organization : University of Washington
Other organizations : Sanofi (United States)
Top 5 similar protocols
Variable analysis
independent variables
- CRISPR-induced homology directed repair to integrate the mNeonGreen coding sequence into the NR4A1 locus before the stop codon
- Electroporation of the mNeonGreen coding sequence flanked by homology arms, T2A element, and recombinant spCas9 and NR4A1 CRISPR guide RNA into Jurkat clone E6-1 cells
- CRISPR knockout of TRA/TRB expression in the reporter cell line
- Expression of the NR4A1_NeonGreen reporter upon PMA (5ng/ml) - ionomycin (5μg/ml) stimulation
- Upregulation of the reporter signal according to TCR signal strength
- Jurkat clone E6-1 cells used as the parental cell line
- NR4A1 CRISPR guide RNA sequence: AUGAAGAUCUUGUCAAUGAU
- TRA/TRB CRISPR guide RNA sequences: AGAGUCUCUCAGCUGGUACA, CAAACACAGCGACCUUGGGU
- PMA (5ng/ml) - ionomycin (5μg/ml) stimulation to induce reporter expression
- Cells with successful TRA/TRB knockout sorted for lack of CD3 expression
Annotations
Based on most similar protocols
Etiam vel ipsum. Morbi facilisis vestibulum nisl. Praesent cursus laoreet felis. Integer adipiscing pretium orci. Nulla facilisi. Quisque posuere bibendum purus. Nulla quam mauris, cursus eget, convallis ac, molestie non, enim. Aliquam congue. Quisque sagittis nonummy sapien. Proin molestie sem vitae urna. Maecenas lorem.
Sign up for free or login to display all annotations
As authors may omit details in methods from publication, our AI will look for missing critical information across the 5 most similar protocols.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!