Chromatin Immunoprecipitation Assay Protocol

Chromatin immunoprecipitation assays were performed essentially as described before (Liu et al., 2018 (link), 2019a (link),b (link); Zeng et al., 2018 (link); Zhang et al., 2018 (link); Li et al., 2018a (link)–e (link), 2019b –f ; Yang Y. et al., 2018 (link); Yang et al., 2019a (link),b (link); Fan et al., 2019 (link); Lu et al., 2019 (link); Shao et al., 2019 (link); Weng et al., 2019 (link); Zhao et al., 2019 (link); Kong et al., 2019a (link),b (link)). Briefly, chromatin was cross-linked with 1% formaldehyde. DNA was fragmented into 500 bp pieces using a Branson 250 sonicator (30% output power; 6 cycles of 10s sonication + 10s intermission). Aliquots of lysates containing 200 μg of protein were used for each immunoprecipitation reaction with anti-MRTF-A (Santa Cruz, sc-32909), anti-Tip60 (Santa Cruz, sc-166323), anti-trimethyl H3K4 (Millipore, 07–473), anti-acetyl H3K9 (Millipore, 07–352), anti-acetyl H3K27 (Millipore, 07–360), anti-acetyl H4K16 (Millipore, 07–328), anti-ASH2 (Bethyl Laboratories, A300–489A), or pre-immune IgG. Precipitated DNAs were amplified with the following primers: Nos2 promoter, 5′-AGAGTGATGTAATCAAGCAC-3′ and 5′-AAAGTTGTGACCCTGGCAG-3′; Gapdh promoter, 5′-ATCACTGCCACCCAGAAGACTGTGGA-3′ and 5′- CTCATACCAGGAAATGAGCTTGACAAA -3′.