Quantifying Mitochondrial DNA Copy Number

Mitochondrial DNA copy number (mtDNA-CN) was determined following a protocol adapted from Fazzini et al. and Singh et al. [39 (link),40 (link)]. Genomic DNA was extracted from snap-frozen liver pieces in 5% Chelex 100 resin (Sigma-Aldrich, St. Louis, MO, USA at 100 °C for 15 min under constant shaking at 500 rpm. After centrifugation at 12,000× g for 1.5 min the yield and purity of the DNA in the supernatant was quantified and a quantitative real-time PCR was performed using the following primer probe combinations: mitochondrial gene, mtRnr2 forward CCTGCCCAGTGACTAAAGTT, mtRnr2 reverse GACAGTTGGACCCTCGTTTAG, mtRnr2 probe ATCCTGACCGTGCAAAGGTAGCAT; nuclear gene, Gusβ forward GAGCTTTCGAAGCAGGAGTAG, Gusβ reverse CCAGGAGAGGTGAAGTGTTATG, Gusβ probe AGATGGACCACACTTCACAGGTCA. Real-time PCR reactions were performed on the CFX96 PCR System (Bio-Rad, Hercules, CA, USA). PCR efficiency was determined by 3-fold serial dilutions of the DNA; mtDNA copy number was calculated using the formula mtDNA-CN = 2 × E^ΔCt. E = 1.9915, which is the qPCR efficiency calculated as the mean amplification factor of the two primer probe combinations and ΔCt equals Ct_nuclear gene—Ct_{mitochondrial} gene.