Generating PTEN-knockout Myc-CaP cell lines

To stably express CAS9 in Myc-CaP cells, we generated VSVG pseudotyped lentivirus^{63 (link),64 (link)} using 293T cells, 2nd generation packaging vectors psPAX2, pMD2.G, and a CAS9 (Streptococcus pyogenes CRISPR-Cas) expressing lentiviral vector (Addgene 52962)^{65 (link)}. Lentiviral infection efficacy was >90% and cells were maintained with 8 μg/ml puromycin. Multiple synthetic guide RNAs (gRNAs) (CRISPR crRNA, Integrated DNA Technologies) were designed using the CRISPR Design Tool (crispr.mit.edu^{66 (link)}), those with off-target effects were excluded. gRNAs were delivered by transient transfection reagent TransIT-X2 (Mirus Bio). Partial PTEN knockout was confirmed by PTEN and p-AKT western blot and IF; >40 clones were isolated by cloning cylinders and were screened for complete PTEN loss. Two complete PTEN knockout Myc-CaP clones from different gRNAs (AAAGACTTGAAGGTGTATAC (exon 2), TGTGCATATTTATTGCATCG (exon 5)) were selected and analyzed in parallel in vitro.

Free full text: Click here

Anker J.F., Naseem A.F., Mok H., Schaeffer A.J., Abdulkadir S.A, & Thumbikat P. (2018). Multi-faceted immunomodulatory and tissue-tropic clinical bacterial isolate potentiates prostate cancer immunotherapy. Nature Communications, 9, 1591.

Publication 2018

CRISPR crRNA TransIT-X2

293t cells Cells Clones Crispr Crrna Exon Infection Pten Puromycin Rnas Streptococcus pyogenes Transfection Transient Vector Western blot

Corresponding Organization :

Other organizations : Northwestern University

Top 5 similar protocols

Protocol cited in 1 other protocol

Variable analysis

independent variables

Lentiviral infection with CAS9 (Streptococcus pyogenes CRISPR-Cas) expressing vector
Multiple synthetic guide RNAs (gRNAs) designed using the CRISPR Design Tool

dependent variables

PTEN knockout in Myc-CaP cells
P-AKT levels (as a measure of PTEN knockout)

control variables

Puromycin selection (8 μg/ml) to maintain CAS9 expression
Transient transfection of gRNAs using TransIT-X2 reagent

controls

Positive control: Myc-CaP cells with complete PTEN knockout confirmed by western blot and immunofluorescence
Negative control: Not explicitly mentioned

Annotations

Based on most similar protocols

Etiam vel ipsum. Morbi facilisis vestibulum nisl. Praesent cursus laoreet felis. Integer adipiscing pretium orci. Nulla facilisi. Quisque posuere bibendum purus. Nulla quam mauris, cursus eget, convallis ac, molestie non, enim. Aliquam congue. Quisque sagittis nonummy sapien. Proin molestie sem vitae urna. Maecenas lorem.

As authors may omit details in methods from publication, our AI will look for missing critical information across the 5 most similar protocols.

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!