Methylation Analysis of ADHFE1 Promoter

The methylation status of the CpG dinucleotides in the ADHFE1 promoter was analyzed. A bisulfate-sequencing assay was performed using 1.0 mg of bisulfite-treated genomic DNA from the clinical samples. Bisulfite conversion was performed using the EpiTect Bisulfite Kit (QIAGEN, German) according to the manufacturer’s instructions. The fragments of interest were amplified using the following specific primer pairs designed with the MethPrimer software4 (link)7 (link): forward, 5′- GGAGATGGAGTGAAGGTTGTTT-3′; reverse, 5′- ATTAACTCAAAACCCCTCTCTCTC −3′. The PCR products were gel purified and cloned into the pMD19-T vectors using pMD19-T vector cloning kit (TAKARA, Japan). Individual bacterial colonies were picked and sequenced to analyze DNA methylation19 (link)

Partial Protocol Preview
This section provides a glimpse into the protocol.
The remaining content is hidden due to licensing restrictions, but the full text is available at the following link: Access Free Full Text.

Hu Y.H., Ma S., Zhang X.N., Zhang Z.Y., Zhu H.F., Ji Y.H., Li J., Qian X.L, & Wang Y.X. (2019). Hypermethylation Of ADHFE1 Promotes The Proliferation Of Colorectal Cancer Cell Via Modulating Cell Cycle Progression. OncoTargets and therapy, 12, 8105-8115.

Publication 2019

EpiTect Bisulfite Kit pMD19-T vector cloning kit

Assay Bacterial Bisulfite Cpg dinucleotides Genomic Methylation Primer

Corresponding Organization :

Other organizations : Xinxiang Medical University, First Affiliated Hospital of Xinxiang Medical University

Top 5 similar protocols

Variable analysis

independent variables

Methylation status of the CpG dinucleotides in the ADHFE1 promoter

dependent variables

Methylation status of the CpG dinucleotides in the ADHFE1 promoter

control variables

Bisulfite-treated genomic DNA from the clinical samples
Bisulfite conversion using the EpiTect Bisulfite Kit (QIAGEN, German)
Primer pairs designed with the MethPrimer software
PCR products gel purified and cloned into the pMD19-T vectors using pMD19-T vector cloning kit (TAKARA, Japan)
Individual bacterial colonies picked and sequenced to analyze DNA methylation

Annotations

Based on most similar protocols

Etiam vel ipsum. Morbi facilisis vestibulum nisl. Praesent cursus laoreet felis. Integer adipiscing pretium orci. Nulla facilisi. Quisque posuere bibendum purus. Nulla quam mauris, cursus eget, convallis ac, molestie non, enim. Aliquam congue. Quisque sagittis nonummy sapien. Proin molestie sem vitae urna. Maecenas lorem.

As authors may omit details in methods from publication, our AI will look for missing critical information across the 5 most similar protocols.

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!