Molecular biology was performed following standard methods. Gateway recombination technology (Invitrogen, CA) was used for expression vectors. Table S2 describes the details of constructs generated in this study. We amplified 3.5 kb genomic sequences of dnj-17 with 0.9 kb 5′ upstream sequences to 0.1 kb 3′ downstream region using the following primers: YJ11121 AAACTCCATCAACCTGACTTCCCTG and YJ11122 TTGCCCATTATTCTTCCCGAAAC. To determine the gene structure of dnj-17 , we isolated mRNAs from mixed-stage animals of N2 wild type and CB156 unc-25 (e156 ) dnj-17 (ju1162 ) using Trizol (ThermoFisher Scientific). Complementary DNA (cDNA) synthesis was performed using SuperScript III (ThermoFisher Scientific), with random primers according to the manufacturers’ instructions. We performed RT-PCR using SL1 primer GTTTAATTACCCAAGTTTGAG and a reverse primer p3 GCGACCAGATTCCTAATTTGCTCGTTC designed on the junction of exon 3 and exon 4 to determine the first exon of dnj-17 mRNA, and p2 ATGAAATGCCATTACGAAGTGCTC and p4 AATGTTTCACCAATCCTCATCATCC primers designed on the first and sixth exon to verify the coding sequence. Sequences of all clones were verified by Sanger sequencing. Protein domain analysis was performed using NCBI domain database (Marchler-Bauer et al. 2015 (link)) and Treefam (Li et al. 2006 (link)).
Free full text: Click here
