Quantitative SIV RNA Measurement

SIV RNA concentration in the plasma and CSF samples were measured by quantitative reverse transcription-PCR (qRT-PCR) as previously described (83 (link)). In brief, plasma was separated from blood samples collected in K2-EDTA vacutainer tubes (Becton, Dickinson, San Diego, CA, USA) within 4 h of collection. RNA was extracted from 140 µl of plasma and CSF samples using a QIAamp viral RNA minikit according to the manufacturer’s instructions (Qiagen, Germantown, MD, USA; cat. no. 52906). SIV gag RNA was quantified by qRT-PCR using the TaqMan RNA-to-Ct 1-Step kit (Thermo Fisher Scientific, MA; cat. no. 4392938) and Applied Biosystems QuantStudio 3 real-time PCR system (Applied Biosystems, Waltham, MA, USA). Primers and probes used for SIV gag RNA quantification were as follows: SIVGAGF, 5′-GTCTGCGTCATCTGGTGCATTC-3′; SIVGAGR, 5′-CACTAGGTGTCTCTGCACTATCTGTTTTG-3′; and SIVP, 5′-/6-carboxyfluorescein (FAM)/CTTCCTCAG/ZEN/TGTGTTTCACTTTCTCTTCTGCG/3IABkFQ-3′.