Generation of Single and Double Knockout Cell Lines

PARP1, PARP7, STING, and TBK1 single‐gene knockout cells were generated by lentiviral transfection followed by puromycin selection. The pLenti CRISPRv2 vectors inserted with specific sgRNA oligos were transfected together with psPAX2 and pMD2G to product lentiviruses. The sgRNA sequences designed for human PARP1 knockout were 5′‐CGATGCCTATTACTGCACTG‐3′, 5′‐AGCTAGGCATGATTGACCGC‐3′, and 5′‐CCGGCACCCTGACGTTGAGG‐3′; sgRNA sequence designed for human PARP7 knockout was 5′‐CACTGAAGCTCCAGAACGAG‐3′; sgRNA sequence designed for human STING knockout was 5′‐GGCTGTCACTCACAGGTACC‐3′; sgRNA sequence designed for human TBK1 knockout was 5′‐AGAGCACTTCTAATCATCTG‐3′; sgRNA sequence designed for mouse Parp1 knockout was 5′‐ CGAGTGGAGTACGCGAAGAG‐3′; sgRNA sequence designed for mouse Parp7 knockout was 5′‐AAGGATGCGCTTCTGGTAAT‐3′.
HT‐29 PARP1^−/− PARP7^−/− double genes knockout cells were conducted by transfecting HT29 PARP7 KO clone cells with lentiviral containing specifically edited pLX‐sgRNA followed by blasticidin selection. The sgRNA sequences designed for PARP1 knockout was 5′‐ CGATGCCTATTACTGCACTG‐3′.