Comprehensive Microbiome Analysis via ITS and 16S Sequencing

Oral rinse samples were processed individually using the Fast DNA Spin Kit following manufacturer's instructions (BIO 101; Vista, CA). Each extraction tube was agitated three times using a Fast Prep FP120 instrument at a speed setting of 5 for 30 s. Tubes were cooled on ice between agitations. Fungi and bacteria present in these samples were identified with ITS-based and 16S probes, respectively. The ITS1 region from DNA sample extracts was amplified in triplicate using primers with high specificity for ascomycete fungi (fluorescently labeled forward primer ITS1F (CTTGGTCATTTAGAGGAAGTAA) and unlabeled reverse primer ITS2 (GCTGCGTTCTTCATCGATGC). The ITS primers were selected in this study to detect the presence of various fungi since these primers are able to detect consensus sequences present in a broad range of fungi [16] (link), [17] (link). For bacterial identification, extracted DNA was amplified by PCR using routinely employed universal primers [fluorescently labeled forward primer 27F (5′-6FAM- AGAGTTTGATCCTGGCTCAG-3′) and unlabeled reverse primer 355R5′ (5′- GCTGCCTCCCGTAGGAGT-3′)] [18] (link), which amplify the first two hyper-variable regions of 16S rRNA [19] (link) and are commonly used for microbiome analysis [10] (link), [20] (link). Microbiome analysis was performed using multitag 454 pyrosequencing (MTPS) technique, which was used for characterization of nucleic acids [21] (for details, please see Method S1).