We assembled three pairs of transcription activator-like effector
nucleases (TALENs) that target exon 15 of ferret Aspm, which
encodes the second CH domain, and cloned into a mammalian expression vector with
the CMV and T7 promoters through a commercial service (PNA Bio). Gene targeting
efficiency of each TALEN pair was tested in HEK 293T cells using a split
GFP-based reporter30 (link). The most
efficient pair, targeting
TGAGAGCATAAAGCTGTTGATGGAGTGGGTAAATGCTGTTTGTGCTTTCTATA(target-spacer-target) was
chosen for genome editing in vivo. These plasmids are available
through Addgene.org. For mRNA synthesis, endotoxin-free TALEN plasmids were
prepared using NucleoBond Xtra Midi EF kit (Clontech), ethanol-precipated 3
times, linearized with ScaI digestion (New England BioLabs), and gel purified.
mRNAs were synthesized using mMessage mMachine T7 ULTRA kit (ThermoFisher
Scientific), cleared by MEGAclear transcription clean-up kit (ThermoFisher
Scientific). Of note, we performed the optional ammonium acetate precipitation
to improve the quality of the mRNAs. The TALEN mRNAs were diluted in sterile
EmbryoMax injection buffer (Millipore) at 50 ng/μl, aliquoted, and kept
frozen at −150 °C until used.