DNA was subcloned from plasmid constructs gifted by C. Moens (University of Washington, Seattle, Washington, USA) containing full-length zebrafish sema3fa and sema3fb in pCR4 vectors, RNA transcribed by mMessageMachine (Ambion) and microinjected into one-cell-stage embryos. All MOs were from Genetools. One-cell-stage embryos were microinjected with pre-mRNA translation blocking MO to sema3fa (17 (link)) or splice blocking MO targeting the exon3/5 boundary of sema3fb, 5′TATGAAGCGATACTCACGTTTGTGT3′. Efficacy of sema3fb knockdown was confirmed by RT-PCR (Supplemental Figure 2). The control MO was CCTCTTACCTCAGTTACAATTTATA.
Other organizations :
University of Edinburgh, Centre for Inflammation Research, University of Sheffield, Immunité et Cancer, Massachusetts General Hospital, Harvard University, Shriners Hospitals for Children - Boston, Cancer Research UK Scotland Institute, University of Glasgow
Microinjection of pre-mRNA translation blocking MO to sema3fa
Microinjection of splice blocking MO targeting the exon3/5 boundary of sema3fb
dependent variables
Knockdown efficiency of sema3fb, confirmed by RT-PCR
control variables
Control MO sequence: CCTCTTACCTCAGTTACAATTTATA
controls
Positive control: None mentioned
Negative control: Microinjection of control MO
Annotations
Based on most similar protocols
Etiam vel ipsum. Morbi facilisis vestibulum nisl. Praesent cursus laoreet felis. Integer adipiscing pretium orci. Nulla facilisi. Quisque posuere bibendum purus. Nulla quam mauris, cursus eget, convallis ac, molestie non, enim. Aliquam congue. Quisque sagittis nonummy sapien. Proin molestie sem vitae urna. Maecenas lorem.
As authors may omit details in methods from publication, our AI will look for missing critical information across the 5 most similar protocols.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to
get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
