Zebrafish Sema3f Knockdown Protocol
Corresponding Organization :
Other organizations : University of Edinburgh, Centre for Inflammation Research, University of Sheffield, Immunité et Cancer, Massachusetts General Hospital, Harvard University, Shriners Hospitals for Children - Boston, Cancer Research UK Scotland Institute, University of Glasgow
Variable analysis
- Microinjection of pre-mRNA translation blocking MO to sema3fa
- Microinjection of splice blocking MO targeting the exon3/5 boundary of sema3fb
- Knockdown efficiency of sema3fb, confirmed by RT-PCR
- Control MO sequence: CCTCTTACCTCAGTTACAATTTATA
- Positive control: None mentioned
- Negative control: Microinjection of control MO
Annotations
Based on most similar protocols
As authors may omit details in methods from publication, our AI will look for missing critical information across the 5 most similar protocols.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!