Primers wbdR attB Fw (5′ggggacaagtttgtacaaaaaagcaggcttcATGA ATTTGTATGGTATTTTTGGT3′) and wbdR attB Rv (5′ggggaccactttgtacaagaaagctgggtcTTAAATAGATGTTGGCGA TCTT3′) were designed based on the sequence of E. coli O157:H71 and according to Gateway Cloning Technology® (Invitrogen, Barcelona, Spain) instructions. Both primers were used to amplify wbdR from the start to the stop codon using E. coli O157:H7 DNA as template, and the resulting product was cloned into pDONR221 (Invitrogen) by site-specific recombination, generating pYRI-5. Then, wbdR from pYRI-5 was transferred by site-specific recombination to pRH001 (Hallez et al., 2007 (link)). The new plasmid (pYRI-6) was introduced in Ba-parental (B. abortus 2308W) by conjugation (Conde-Álvarez et al., 2006 (link)) to obtain Ba-pwbdR (Supplementary Table S1 ).
To obtain a stable B. abortus-wbdR construct, gene wbdR with the 300 bp upstream region containing its promoter was amplified from E. coli O157:H7 using primers wbdR Fw: 5′TTCCCCGGGGGAgaagttcgccacagtaaatcgaa3′ and wbdR Rv: 5′TTCCCCGGGGGAttaaatagatgttggcgatctt3′, and cloned in pGEM-T Easy® (Promega, Madison, WI, United States) to obtain pYRI-21. The construction was verified by sequencing. Then, the EcoRI fragment of pYRI-21 containing wbdR and its promoter was subcloned into the corresponding site of pUC18R6KT-miniTn7TKm (Llobet et al., 2009 (link)) to obtain pYRI-27 (pUC18R6KT-miniTn7T-Km-PwbdR). The miniTn7 vector carrying wbdR with its own promoter was inserted into Ba-parental chromosome II by the method of Choi et al. (2005) (link) and Choi and Schweizer (2006) (link) modified as follows. First pYRI-27 was introduced in E. coli S17.1 λpir and then transferred to Brucella using an E. coli S17.1 λpir (pYRI-27)-E. coli HB101 (pRK2013)-E. coli SM10 λpir (pTNS2)-Ba-parental four-parental mating. The resulting Ba::Tn7wbdRKmR construct was examined by PCR for the correct insertion and orientation of miniTn7 between genes glmS and recG using the following primers: (i) GlmS_B (5′-GTCCTTATGGGAACGGACGT-3′) and Ptn7-R (5′-CACAGCATAACTGGACTGATT-3′) for insertion downstream glmS; (ii) Ptn7-L (5′-ATTAGCTTACGACGCTACACCC-3′) and RecG (5′-TATATTCTGGCGAGCGATCC-3′) for insertion downstream recG; and (iii) GlmS_B and RecG that only amplify the intergenic region in the absence of the mini-Tn7. The presence of only one copy of the miniTn7 was determined by Southern-blot and sequencing.
To obtain a wbdR construct with no Km resistance (Ba::Tn7wbdR), a non-polar kmR mutant of Ba::Tn7wbdRKmR was constructed by overlapping PCR using the Km cassette of pUC18R6KT-miniTn7TKm as template. Primers kmR-F1 (5′-AGGAAGCGGAACACGTAGAA-3′) and kmR-R2 (5′-AATCATGCGAAACGATCCTC-3′) amplified a 318-bp fragment including 312-bp upstream of the kmR start codon and codons 1 to 2 of the kmR ORF, and primers kmR-F3 (5′-gaggatcgtttcgcatgattTTCTTCTGAGCGGGACTCTG-3′) and kmR-R4 (5′-TGGTCCATATGAATATCCTCCTTA-3′) amplified a 268-bp fragment including codons 262–264 of the kmR ORF and 256 bp downstream of the kmR stop codon. Both fragments were ligated by overlapping PCR using oligonucleotides kmR-F1 and kmR-R4 for amplification, and the complementary regions between kmR-R2 and kmR-F3 for overlapping. The resulting fragment, containing the kmR deletion allele, was cloned into pCR2.1 (Invitrogen) and subcloned into the EcoRI site of the suicide plasmid pNPTS138-Cm (Addgene, LGC Standards, Teddington, United Kingdom) to generate plasmid pRCI-65. This suicide plasmid was used to delete the kmR gene of Ba::Tn7wbdRKmR using the allelic exchange by double recombination (Conde-Álvarez et al., 2006 (link)). Deletion of kmR was checked with oligonucleotides kmR-F1 and kmR-R4.
A Ba::Tn7wbdRΔwbkC mutant potentially expressing only the wbdR encoded acetyltransferase was constructed by PCR overlap using genomic DNA of Ba-parental as template. Primers wbkC-F1 (5′-AGGTGGCGACAAACGAATAA-3′) and wbkC-R2 (5′-GCCCATGCCAATCAAGGT-3′) amplified a 393-bp fragment including codons 1–29 of the wbkC ORF (BAB1_0540), as well as 306 bp upstream of the wbkC start codon, and primers wbkC-F3 (5′-accttgattggcatgggcAGATGGTCGGAAGTCCAGATT-3′) and wbkC -R4 (5′-TCTGAACTCGGCTGGATGAC-3′) amplified a 434-bp fragment including codons 212–259 of the wbkC ORF and 287-bp downstream of the wbkC stop codon. Both fragments were ligated by overlapping PCR using oligonucleotides wbkC-F1 and wbkC-R4 for amplification, and the complementary regions between wbkC-R2 and wbkC-F3 for overlapping. The fragment containing the wbkC deletion allele was cloned into pCR2.1 and subcloned into the BamHI and the XbaI sites of the suicide plasmid pJQK (Scupham and Triplett, 1997 (link)). The resulting mutator plasmid pYRI-31 was used to delete the wbkC gene of Ba::Tn7wbdR by allelic exchange (Conde-Álvarez et al., 2006 (link)). The resulting colonies were screened by PCR with primers wbkC-F1 and wbkC-R4, which amplify a fragment of 827 bp in the mutant and a fragment of 1373 bp in the parental strain.
Bme::Tn7wbdRKmR was obtained using the modified miniTn7 site-specific integration vector technology (see above). To obtain Bme::Tn7wbdR and Bme::Tn7wbdRΔwbkC the suicide plasmids pRCI-65 and pYRI-31 (see above and Supplementary TableS1 ) were used.
To obtain a stable B. abortus-wbdR construct, gene wbdR with the 300 bp upstream region containing its promoter was amplified from E. coli O157:H7 using primers wbdR Fw: 5′TTCCCCGGGGGAgaagttcgccacagtaaatcgaa3′ and wbdR Rv: 5′TTCCCCGGGGGAttaaatagatgttggcgatctt3′, and cloned in pGEM-T Easy® (Promega, Madison, WI, United States) to obtain pYRI-21. The construction was verified by sequencing. Then, the EcoRI fragment of pYRI-21 containing wbdR and its promoter was subcloned into the corresponding site of pUC18R6KT-miniTn7TKm (Llobet et al., 2009 (link)) to obtain pYRI-27 (pUC18R6KT-miniTn7T-Km-PwbdR). The miniTn7 vector carrying wbdR with its own promoter was inserted into Ba-parental chromosome II by the method of Choi et al. (2005) (link) and Choi and Schweizer (2006) (link) modified as follows. First pYRI-27 was introduced in E. coli S17.1 λpir and then transferred to Brucella using an E. coli S17.1 λpir (pYRI-27)-E. coli HB101 (pRK2013)-E. coli SM10 λpir (pTNS2)-Ba-parental four-parental mating. The resulting Ba::Tn7wbdRKmR construct was examined by PCR for the correct insertion and orientation of miniTn7 between genes glmS and recG using the following primers: (i) GlmS_B (5′-GTCCTTATGGGAACGGACGT-3′) and Ptn7-R (5′-CACAGCATAACTGGACTGATT-3′) for insertion downstream glmS; (ii) Ptn7-L (5′-ATTAGCTTACGACGCTACACCC-3′) and RecG (5′-TATATTCTGGCGAGCGATCC-3′) for insertion downstream recG; and (iii) GlmS_B and RecG that only amplify the intergenic region in the absence of the mini-Tn7. The presence of only one copy of the miniTn7 was determined by Southern-blot and sequencing.
To obtain a wbdR construct with no Km resistance (Ba::Tn7wbdR), a non-polar kmR mutant of Ba::Tn7wbdRKmR was constructed by overlapping PCR using the Km cassette of pUC18R6KT-miniTn7TKm as template. Primers kmR-F1 (5′-AGGAAGCGGAACACGTAGAA-3′) and kmR-R2 (5′-AATCATGCGAAACGATCCTC-3′) amplified a 318-bp fragment including 312-bp upstream of the kmR start codon and codons 1 to 2 of the kmR ORF, and primers kmR-F3 (5′-gaggatcgtttcgcatgattTTCTTCTGAGCGGGACTCTG-3′) and kmR-R4 (5′-TGGTCCATATGAATATCCTCCTTA-3′) amplified a 268-bp fragment including codons 262–264 of the kmR ORF and 256 bp downstream of the kmR stop codon. Both fragments were ligated by overlapping PCR using oligonucleotides kmR-F1 and kmR-R4 for amplification, and the complementary regions between kmR-R2 and kmR-F3 for overlapping. The resulting fragment, containing the kmR deletion allele, was cloned into pCR2.1 (Invitrogen) and subcloned into the EcoRI site of the suicide plasmid pNPTS138-Cm (Addgene, LGC Standards, Teddington, United Kingdom) to generate plasmid pRCI-65. This suicide plasmid was used to delete the kmR gene of Ba::Tn7wbdRKmR using the allelic exchange by double recombination (Conde-Álvarez et al., 2006 (link)). Deletion of kmR was checked with oligonucleotides kmR-F1 and kmR-R4.
A Ba::Tn7wbdRΔwbkC mutant potentially expressing only the wbdR encoded acetyltransferase was constructed by PCR overlap using genomic DNA of Ba-parental as template. Primers wbkC-F1 (5′-AGGTGGCGACAAACGAATAA-3′) and wbkC-R2 (5′-GCCCATGCCAATCAAGGT-3′) amplified a 393-bp fragment including codons 1–29 of the wbkC ORF (BAB1_0540), as well as 306 bp upstream of the wbkC start codon, and primers wbkC-F3 (5′-accttgattggcatgggcAGATGGTCGGAAGTCCAGATT-3′) and wbkC -R4 (5′-TCTGAACTCGGCTGGATGAC-3′) amplified a 434-bp fragment including codons 212–259 of the wbkC ORF and 287-bp downstream of the wbkC stop codon. Both fragments were ligated by overlapping PCR using oligonucleotides wbkC-F1 and wbkC-R4 for amplification, and the complementary regions between wbkC-R2 and wbkC-F3 for overlapping. The fragment containing the wbkC deletion allele was cloned into pCR2.1 and subcloned into the BamHI and the XbaI sites of the suicide plasmid pJQK (Scupham and Triplett, 1997 (link)). The resulting mutator plasmid pYRI-31 was used to delete the wbkC gene of Ba::Tn7wbdR by allelic exchange (Conde-Álvarez et al., 2006 (link)). The resulting colonies were screened by PCR with primers wbkC-F1 and wbkC-R4, which amplify a fragment of 827 bp in the mutant and a fragment of 1373 bp in the parental strain.
Bme::Tn7wbdRKmR was obtained using the modified miniTn7 site-specific integration vector technology (see above). To obtain Bme::Tn7wbdR and Bme::Tn7wbdRΔwbkC the suicide plasmids pRCI-65 and pYRI-31 (see above and Supplementary Table
Free full text: Click here
