Full-length cDNA encoding WT human KCNQ2 splice isoform 4 cDNA (KV7.2; GenBank accession NM_172108) was engineered in the mammalian expression vector pIRES2_EGFP or a modified vector where EGFP was substituted by CyOFP1. Site-directed mutagenesis of KCNQ2 was performed using QuikChange II XL (Agilent technologies, Santa Clara, CA, USA; mutagenic primer sequences: 5’: TCCCAAATTAAGAGCCTGCAGTCCAGAGTGGAC , 3’: AGGCTCTTAATTT GGGACAGCATGTCCAGGTGGC ) to insert the R581Q (R550Q in isoform 4) patient mutation into the wildtype construct. KCNQ3 (KV7.3; GenBank accession NM_004519) was cloned into pcDNA5/FRT for use in generating the KCNQ3-stable CHO-K1 cells.
TetO-Ngn2-puro (Addgene plasmid #52047) and TetO-FUW-EGFP (Addgene plasmid #30130) plasmids were gifts from Marius Wernig (Vierbuchen et al., 2010 (link); Zhang et al., 2013 (link)). FUW-M2rtTA (Addgene plasmid # 20342) was a gift from Rudolf Jaenisch (Hockemeyer et al., 2008 (link)). Lentiviruses were generated in HEK293T cells using the second-generation packaging vectors, psPAX2 and pMD2.G, as described previously (Zufferey et al., 1998 (link)) by the Northwestern University DNA/RNA Delivery Core.
TetO-Ngn2-puro (Addgene plasmid #52047) and TetO-FUW-EGFP (Addgene plasmid #30130) plasmids were gifts from Marius Wernig (Vierbuchen et al., 2010 (link); Zhang et al., 2013 (link)). FUW-M2rtTA (Addgene plasmid # 20342) was a gift from Rudolf Jaenisch (Hockemeyer et al., 2008 (link)). Lentiviruses were generated in HEK293T cells using the second-generation packaging vectors, psPAX2 and pMD2.G, as described previously (Zufferey et al., 1998 (link)) by the Northwestern University DNA/RNA Delivery Core.
Free full text: Click here
