Real-Time PCR Analysis of CDK6 Expression

Bone marrow mononuclear cells (BMMNCs) were separated using Ficoll-Hypaque (GE Healthcare, United States). Total RNA was extracted from BMMNCs with Trizol reagent (Life Technologies, United States) and reverse transcription to complementary DNA (cDNA) was performed using PrimeScript Kit (TaKaRa, Japan) as described in our previous reports (Liang et al., 2017b (link)). Real-time PCR using ChamQ Universal SYBR Green Master Mix (Vazyme, China) was completed on the ViiATM7 RT-PCR system (Applied Biosystems, United States). The primers used for CDK6 expression were the following: forward, 5′–3′ CTGAATGCTCTTGCTCCTTT; reverse, 5′–3′ AAAGTTTTGGTGGTCCTTGA. Relative CDK6 expression mRNA levels were calculated by 2^–ΔΔCT and were normalized to internal control (β-actin).