Molecular Identification of Parasitic Fluke Eggs

The morphological characteristics of O. viverrini (Ov) and minute intestinal flukes (MIFs) eggs are similar. So, the Ov egg was confirmed by specific PCR amplification from genomic DNA using OvNad5 primer as previously described [30 (link)]. PCR amplifications were done by using GoTaq® Colorless Master Mix (Promega, USA) containing 3 µL of genomic DNA, and 25 pmol of each forward and reverse primer (OvNad5-F: TTTGCGGAGGTTTGTTACCT and OvNad5-R: CACCTCACCAATTCAACACG) in a thermal cycler (Mastercycler nexus Eppendorf flexlid, Germany). The amplification steps were including initial denaturation at 95ºC for 5 min, followed by 35 cycles of denaturation at 95ºC for 1 min, annealing at 55 ºC for 1 min, extension at 72 ºC for 1 min, and one cycle of a final extension at 72 ºC for 10 min. The PCR products were size separated on 2% agarose gel containing ViSafe Red Gel Stain (Vivantis, USA) using 1X TBE buffer at 80 V for 2 h. The PCR products were confirmed for their correction by DNA sequencing service (Macrogen, Republic of Korea).