Genotyping Transgenic Mouse Alleles

Ear biopsy (or sperm from mosaic males, taken directly from the uterus of a euthenased female on the day following coitus) was used to prepare genomic DNA as previously described (Arthur et al., 2000 (link)). Mouse genotypes were determined by PCR analysis using primers w and x above, Cre primers Cre-F (GATCGCTGCCAGGATATACG) and Cre-R (AATCGCCATCTTCCAGCAG) which gives a PCR product of 574 bp when a Cre transgene is present; Primer-y (GGTCAGCCAGTCTAGCCAAG) and primer-z (GTGGTTGCCATTCAAGTGTG) amplify products of 411 bp for the wild type allele and 566 bp for the bi-floxed Endoglin allele. PCR using primer-x with primer-y gives a product of 602 bp only in the presence of the Eng^Δex5-6 allele, and no detectable PCR product is amplified from a wild-type allele.