hDPCs were seeded in 6-well plates at a density of 1 × 105 cells/well, and then the cells were treated with GAM or PAM at 30W for 10 s. After incubation for 18 h, RNA was extracted using Trizol reagent (Ambion, CA, USA) and was converted to cDNA using Verso cDNA Synthesis Kit (Thermo Scientific, UT, USA). The quantitative RT-PCR was performed using Applied Biosystems™ SYBR Green Master Mixes (Thermo Scientific, UT, USA) and analyzed by QuantStudio 1 Real-Time PCR System (Thermo Fisher Scientific, UT, USA). The lists of primers are indicated below. FER:FW5′TGA AGA GCA GAC CCG TTT GG3′.RW5′AGC GTG TCC ATG ATG AGG TG3′.USP47:FW5′GGC TTC TAC TAG GTG GCG TC3′.RW5′TCA CCA TCA CTT CTC CAG GT3′.INPP5D:FW5′GGG AGA AAG TCC TCC GAC AC3′RW5′CAA ACA TCT CGG GCT TCG TC3′Versican:FW5′TGT GTT TCA CTA CAG GGC GG3′.RW5′GCG TCA CAC TGC TCA AAT CC3′LEF1FW5′TCCCGTGAAGAGCAGGCTAAAT3′RW5′TTGTCTCTTGCAGACCAGCCT3′GAPDH:FW5′GAC CAC AGT CCA TGC CAT CAC T3′RW5′TCC ACC ACC CTG TTG CTG TAG3′
Free full text: Click here